Homework Help

Hello there! I have a project about making a mousetrap catapult that throws medium sized marshmallows. We have to make it adjustable, and it needs to be ablate fire at a target. Do you guys have any tips? [PS. I only have small VICTORTM mousetrap]

Can u tell me if i am going right if i say that the tension in the string is 20N and that 20N is cancelled by the other 20N force i.e F so the acceleration will be zero.

Hi there, For a university project me and my project group have to make a model (in Matlab) of a trifilar pendulum in such a way that it accurately represents the motion of the pendulum in real life. In order to do so we have to come up with all the physics formulas related to the pendulum. One of those is the resistive torque caused by the pendulum disk being in contact with the center shaft. This causes for a resistive torque due to which the disk will be slowed down as it is rotating. My question now is: how can I calculate this resistive torque? I know that Coulumb's friction law equals Ff = μ * N and I am sure I can find out what the friction coefficient …

Show that if you add a total derivative to the Lagrangian density \( L \to L + \partial_\mu X^\mu \), the energy momentum tensor changes as \( T^{\mu\nu} \to T^{\mu\nu}+\partial_\alpha B^{\alpha\mu\nu}\) with \( B^{\alpha\mu\nu}=-B^{\mu\alpha\nu}\). The Lagrangian can depend on higher order derivatives of the field. Attempted Solution: So we have \( T_{\mu\nu}=\frac{\partial L}{\partial(\partial_\mu \phi)}\partial_\nu \phi-g_{\mu\nu}L\), where \( \phi\) is the field that the Lagrangian depends on. If we do the given change on the Lagrangian, the change in \( T_{\mu\nu}\) would be \( \frac{\partial (\partial_\alpha X^\alpha)}{\partial(\partial_\mu \phi)…

(THEORY) How do I go in calculating the amount of grams of NA2HPO AND NAH2PO4 will be required to prepare 250ml of 0.2mol SODIUM PHOSPHATE buffer of pH 6.4 assuming the pKa (I) is 2.12, pKa (II) is 6.8 and pKa (III) is 12.13 ?!

Hello, I have got this question i'm having difficulty with... Here it is: (b) A beaker contains 250cm3 of 0.3 mol dm-3 calcium hydroxide Ca(OH)2 solution. (i) How many moles of calcium hydroxide are present in 150cm3? (ii) What mass of calcium hydroxide is present in the solution? Can someone please help me to breakdown question b(ii), Here is my answer: 250cm3 in dm3 is 250/1000 = 0.25dm3 0.25 x 0.3 = 0.0075 moles of calcium hydroxide so... 0.0075mol x 74mr = 0.555g of calcium hydroxide?

I need to use the equation wsinθ=nƛ to find w or width. I know θ = 0.6, and ƛ (wavelength?)=655nm. But I have no idea what the n variable means. I looked it up on wiki (well wiki was one of the only site that recognized the equation) and it said "n is any integer". I'm fairly certain plugging in any integer will not produce the correct width. In an earlier equation (tanθ=yn/L) n appears as a subscript. in this case the value I was plugging in was y1 so should I plug 1 into wsinθ=nƛ ?

A ball is kicked with an initial speed of 20m/s at an angle of 50° above the horizontal. What maximum height does the ball reach? Equations: Vfx=VicosΘ Δx=VicosΘt Vfy=(VisinΘ)+ay⋅t (Vfy)^2=(VisinΘ)^2+2ay⋅Δy Δy=1/2(Vfy+(VisinΘ))⋅t I know that the final velocity for both x and y is 20m/s if that is the case. The acceleration for the x-direction is 0m/s^2 while its -9.8m/s^2 due to earth gravitational acceleration. Vfy at max height is 0. Known: Vfx and Vfy= 20m/s Θ=50° Vfy=0m/s ax=0m/s^2 ay=-9.8m/s^2 T=? Δy=? Δx=? I'm assuming that the question is asking for max height as Δy in t…

A turtle and a rabbit engage in a footrace over a distance of 4.00km. The rabbit runs 0.500km and then stops for a 90min nap. Upon awakening, he remembers the race and runs twice as fast. Finishing the course in a total time of 1.75h, the rabbit wins the race.A) Calculate the average speed of the Rabbit. ~I knew how to find the avg speed by dividing 4.00km and 1.75h. i got 2.28km/hB) What was his average speed before he stopped for a nap? Assume no detours or doubling back. ~I converted the break of 90min to 1.5h. and i know that more than one step is required to answer this. I just don't know where to start.The question is asking to find the answers in km/h

HI all, I'm studying safety procedures with chemical substances as preparation for a lab, and my question is why copper salts can't end up in a landfill. I know they are highly toxic to living things and landfills have an effect on the environment around them, and that they are dangerous if untrained perssonnel are handling them, but is there more? Thanks!

Hello, I am Duckie. Is there anyone who know's questions in the Science Olympiad based on Anatomy and Physiology? It would help a lot! Thank you.

If you subtract two values that have uncertainty do you add the uncertainty? Do you use absolute uncertainty and then turn it into relative uncertainty somehow or can you use the relative uncertainty? I am doing an assignment on isotonic points for vegetables. I have found percentage change for mass and have uncertainty for initial and final mass and I need to be able to say something like for the found isotonic point relative uncertainty for initial is -+20% and for final it is -+24% therefore the uncertainty for the isotonic point is ____. Not sure if that makes sense but I tried.

I have read through the associated text for hours:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2795070/The author says that he weighted for body-weight and body-height, but did not say for which diagram.

I need to know what a corresponding point means or is, in terms of: Suppose the point P(2,3) is on the function f(x). Find the point that corresponds to P on each function; show or explain how you figured this out. (a) f (x + 4) (b) f (x) + 3 (c) -2 f (x)(d) 1/2 f (x - 5) + 1

This question is not a homework, but it has been bothering me for a long time. If you know the algorithm, please let me know. The detail of the question is https://www.papeeria.com/d/file/15def8a2-7af6-4670-a776-7c9455d90206/15def8a2-7af6-4670-a776-7c9455d90206.pdf/Demo - main.pdf I am a beginner. If the concept is wrong, please correct me.

I figured out (a) but I am having trouble with (b):(a) What is the efficiency of an out of condition professor who 2.10e5 J of useful work while metabolizing 500 kcal of food energy?(b) How many food calories would a well-conditioned athlete metabolize in doing the same work with an efficiency of 25%?2. Relevant equationsOE + Wnc = OEfη = Work_out / Work_inWork_in = η * work_out3. The attempt at a solutionFor (a) I converted the calories to Joules1 kcal = 4184 J500 kcal (4184J/1 kcal) = 2.1e6 Jη = W_out/W_inη = (2.10e5J) / (2.10e6J)η = 10%(b) I assume I could input the 25% into the equation and work backwards but it's not giving me a correct anwser. I've tried the followi…

Anyone help me with this primer design question? I have searched everywhere on the internet but cant seem to get everything I need. So far I understand that https://imgur.com/a/PfwAhO0 Forward primer is: Restriction enzyme start codon Tag Primer 20 bases from sequence of gene EcoRI Strep tag Primer 20 bases of gene So I got 5' GAATTC ATGGCCTCGTGGTCGCATCCGCAGTTCGAGAAGTCGGGGGTG ATGCGGCTCTGCATCCCGCA 3' Reverse primer is: Restriction enzyme Tag …

Hello, I an having a bit of trouble with my saltwater batteries, I'm trying to hook them up to get more power but it is not working quite as I planned and could use some hints. I get 0.20v from one saltwater cell, if I couple 2 together I get 0.40v, but if I add more, currently got 4 cells connected, I get 0.13v. They are hooked positive to negative and I use a multimeter to check the voltage, its called "Lini-T UT20B, the setting is the 1.5v battery testing. I use Coper Wire for the positive, and aluminium foil for negative. Hints would be greatly appreciated.

Hi. So I have a rube goldberg I made in Algodoo and I have to finish a qualitative and quantitative description of it. I am getting an A in this class and I don't know why but there are two parts that I am having trouble with in my machine. If anyone can help. #1. The first is the collision on the top of the incline. I have to provide the equations and calculate the transfer of energy and momentum from the ball at the bottom of the ramp to the ball at the top. A ball drops into a hole, rolls horizontally for a few meters then rolls up an incline where it interacts with another ball at the top being held there by a lever. The ball going up the ramp pushed the smaller …

I’m not a student, I just have a science question that didn’t seem to fit anywhere else, and the specific sub-forum for those type of questions seems to not have a lot of traffic. Please forgive me if I posted this incorrectly/feel free to move or direct me in the right direction. Small conflict that I’d love to have explained regarding PPD as an accurate measure of UVA1 rays in the spectrum of 340nm - 400nm. UVA1 rays at or above 360nm seem to confer the most damage to skin such as induction of matrix metalloproteinases (i.e., MMPs/collagen degradation enzymes) and secretion of inflammatory cytokines. (1) The Textbook of Cosmetic Dermatology, 2010 Edition, pag…

is the fine-tuned universe an accepted scientific fact (or theory) or is it just an anthropological centred way of explaining things ?

hello, for a project in my schools i just need an magnitude of the resistive torque created by the blades of a drone(with 4 blades) if you have sources or an easy way to calculate this it would be perfect !! thank you in advance and i'm sorry if i'm not understandable, i'm french and not very good in english so don't esitate to ask me to reformulate

Factorial is given by moving left side of a number till 1. 4! =4*3*2*1 3!=3*2*1 2!=2*1 1!=1 But one is on right side of 0. How can we say that 0!=1 It must be 0. Please clear it.

I am done with my homework this week but there is one question that I could not get anywhere with: A moonshiner makes the error of filling a glass jar to the brim and capping it tightly. The moonshine expands more than the glass when it warms up, in such a way that the volume increases by 0.6% (that is, ΔV/V0 = 6 ✕ 10-3) relative to the space available. Calculate the force exerted by the moonshine per square centimeter if the bulk modulus is 1.9 ✕ 109 N/m2, assuming the jar does not break. Answer __________ N/cm2 It later asks if the jar survives which I can figure out on my own but I do not even know where to start with this. I've read the weekly chapters …