blazinfury

I am having trouble reading a Sanger Sequenced gel. I have tried to reason it out and would appreciate someone commenting about how I am approaching this. Thank you. When one does Sanger sequencing, the DNA strands are separated from each other and primers are used to sequence a portion of the DNA. Now, the template strand is used (and NOT the coding strand) in sequencing correct? If so, lets say that you have this gel below. If the gel is read bottom to top, you are reading 5' to 3' of the coding stranding, correct? So in this case, that would mean that the coding strand is: 5' ACGCCCGAGTAGCCCAGATT 3'. This strand is the complement of my template strand and thus, my template strand would be 5' AATCTGGGCTACTCGGGCGT 3'. If I were asked for the mRNA sequence, I would just take the complement of the template strand or just replace all of the T's with U's in the coding strand, correct. So my mRNA sequence would be 5' ACGCCCGAGUAGCCCAGAUU 3'. Is this correct?

B-cells mature in the bone marrow. The spleen is a secondary lymphoid organ where B cells reside awaiting antigens. I recall reading somewhere that B cells can mature in the spleen, but not in adults. Does this happen in kids and if so until what age and why? Thanks.

Pardon the foolish question, but I am trying to understand the purpose and function of the placenta and umbilical cord. During birth, the umbilical cord is responsible for providing the baby with nutrients, oxygen, removes waste, etc. During birth, the umbilical cord is clamped which leads to a physiological response that ultimately results in the baby taking its first breath. What I do not understand is what purpose the placenta plays during development and birth of the fetus?

If you mixed 500 ml of 2 M NaOH with 6 M H2SO4 and they asked you to find the volume to neutralize only the first proton of the acid. When you do NV=NV, you are finding the volume at equivalence but it's the volume to neutralize both protons. So in this case would you half the volume that you get from the NV formula?

If a student were performing a weak acid with strong base titration, and he used a stronger base than titrant as the indicator, what effect would this have on the final ph of solution detected? I would think that since the indicator is a better base it would abstract protons before the base would and thus you would detect a higher ph than expected.

So bond energy is the same bond enthalpy, which means the amount of energy needed to break the bond. Based on this definition, you would need to put in more energy to break the bonds of cyclohexane than cyclopropane due to the increased stability of cyclohexane, correct? From a combustion rxn, which would yield more energy: cyclopropane or cyclohexane? I would think cyclopropane due to the high ring strain within the molecule.

What is the difference b/w alkolotic and acidotic and neutral diarrhea and how could each come about?

I disagree with that notion. Because if it is a very cold day and you touch a door knob, you can get shocked.

Why is it that a person is more readily to get shocked during the winter than during the summer? Is it because air is drier during the winter and thus the air acts as a better dielectric (closer to vaccuum conditions) and makes air a better capacitor, while during the summer the air is moist and humid and so there is greater impediance and the air is a worse capacitor.

So are you saying that the effect is transient in terms of as long as the uncoupler is present it's effects will be felt but once it's gone the membrane will return to normal.

Thank you very much for the clarification.

Lets say I am discussing uncouplers of the electron transport chain, like aspirin. Wouldn't it destroy the proton gradient and in the process also decrease the amount of ATP produced?

An uncoupler is a chemical destroys the proton gradient by poking a hole in the membrane and so the protons from the inter membrane space leak back into the matrix. As a result, you should have less protons going into ATP synthase and thus less ATP. Is this correct logic and conclusion?

@Shaken, That makes sense, but my only qualm with that is that tangential speed can change and so can tangential direction. For instance, if you have a rollercoaster, the coaster slows down at the top and speeds up at the bottom. Isn't that indicative of tangential velocity changes due to both speed and direction changes?

When an object undergoes centripetal motion, it's centripetal velocity is always changing direction and thus it's centripetal acceleration is non-zero but a constant value. My quest is about tangential velocity and acceleration. As an object spins, it's tangential velocity is always changing due to direction and in some cases magnitude (ex. roller coaster). So this would mean that tangential acceleration is also non-zero but a constant value, correct?

That clarified a lot. Thank you for the awesome explanation. So then the forces involved in heat engines are not conservative and thus work is path-dependent. However, why is heat (q) in U=Q+W, path dependent-- also b/c it is not caused by conservative forces?

I am confused about whether work is path independent or not. If one were to drop a pen from a height of 5 m or to throw a pen parabolically from 5 m, the work done would be the same-- thus indicating that work is path independent. However, when one is talking about engines and refrigerators, work is deemed to be path-dependent based on U=Q+W. Would someone please clarify and reconcile this confusion. Thanks.

Thank you so much for the clarification.

Cool. So if someone is Rh+, they possess the antigen but not the antibody; while someone who is Rh- posses the antibody but not the antigen. Thus, an Rh- cannot receive blood from an Rh+ b/c at the instant that the Rh+ antigens are detected, you will have an immune response-- ie agglutination.

A non-competitive inhibitor tends to bind at an allosteric site and prevents enzyme function. However, can the substrate still bind the enzyme even though there will be no activity as long as non-competitive inhibitor is bound? Or does the active site change conformation as well, thus preventing the substrate from binding?

In order to not have an immune response, both the donor and recipient must be RH negative (assuming of course that the recipient can accept the donor's blood)? So if either the donor or recipient is RH+, an immune response will result, correct?

I am trying to understand the speed of sound formula [v=sqrt (B/p)] where v= speed of sound; B=restoring force/molecular Kinetic energy; p= molecular inertia/density. Sound travels fastest through solids than liquids and gases. Aren't solids denser than the other phases (except for water where liquid is denser than ice)? If so, then shouldn't denser materials transmit sound better? Also, what does the Restoring Force variable (B) represent on a molecular level and how should I think about it conceptually to make sense? Thanks.

If a -RNA virus were to infect eukaryotic cells, that virus would need to carry its own polymerase to first become a +RNA virus and then use the host cells machinery to undergo translation, correct? Under what circumstances would that virus choose to use reverse transcriptase and become DNA and what would the benefit of that be to the virus? Is it to replicate its own DNA by going Lysogenic and then excising itself?

Point well taken but if let's say that two if the bands are 600 and 750 kda, wouldn't you increase gel % to better separate them regardless of where they are on the gel?

Awesome explanation. Now it makes sense where inductive and repressive come from-- the relationship between substrate and repressor. But wouldn't you say that the lac is neg feedback because an excess of lactose would inhibit the system. However the trp would be positive feedback where an excess of substrate would keep the system active?