pmtu79

Lastweek, I synthesized cDNA from HEK293 cells and amplify RAD51-AP1 mRNA (BC016330.1) by PCR with the annealing temp of 65oC and with following primers: F-EcoRI: AT GAATTC A ATGGTGCGGCCTGTGAG; R-BamHI: AA GGATCC TCAGGTGCTAGTGGCATTTG and then I cloned this amplified fragment into P3XFLAG-CMV10 vector. However, the result of sequencing showed that I already cloned another gene which is CORO7-PAM16 mRNA. Please help me.