metalgear21

I understand that primers need to be designed with specific requirements depending on the DNA template that's being amplified. I know what a primer does, it anneals to the single stranded DNA molecules after denaturation to allow polymerase to synthesize a new DNA strand. I dont know much about mutagenesis only that Mutagenesis involves incorporating a mutation into the DNA such as by a mismatching base used on the primer. I just dont fully understand the rules when it comes to designing the primers.

Anyone help me with this primer design question? I have searched everywhere on the internet but cant seem to get everything I need. So far I understand that https://imgur.com/a/PfwAhO0 Forward primer is: Restriction enzyme start codon Tag Primer 20 bases from sequence of gene EcoRI Strep tag Primer 20 bases of gene So I got 5' GAATTC ATGGCCTCGTGGTCGCATCCGCAGTTCGAGAAGTCGGGGGTG ATGCGGCTCTGCATCCCGCA 3' Reverse primer is: Restriction enzyme Tag Primer compliment of 20 bases from end of gene Stop codon BamHI Hexa Histidine tag Primer stop codon So I got 3' GGATCC GTGGTGGTGGTGGTGGTG TGCACCAGCCGCACAATGAATAA 5' I know this is not correct. Is the question asking for two sets of primers considering it gives two restriction enzymes? Are the restriction enzyme recognition sites that are given supposed to be in the gene sequence in the question because I cant find them in it? Also which start and stop codon do you use in the gene sequence as there is multiple ones of both? Any help or guidance would be greatly appreciated as this topic is driving me mad