phoenix

Oh, I think I'm beginning to see what you may have meant - although I am unconvinced in so far as lack of an example is concerned! Something like this might have an application: acgtgtatgctgctgatcgtgtgttgtg<gene>agtacacggagcatgcgt<RNA>agtcgtcacccagtc<CDS>acgtgtgtca</CDS></RNA> The question remains whether sequence features are always hierarchic, and I have a strong intuitive feeling that they are not! How are you going to illustrate complex protein kinks in a markup language? Genetic engineering, in so far as whole organisms are concerned, must take account first of DNA sequence features, second of RNA folding, third of the four levels of protein structure, plus chemical gradients and structures that establish tissues and wire up neurons in the right places, etc. etc. It sounds more like a streaming format would be required rather than a human-readable markup language (that is the entire point of a markup language!) So to repeat my previous words, with emphasis: Sayonara, can you please stop bullshitting about representing DNA or protein sequences in a markup format? So I'm not sure whether I can be judged to have been owing you an explanation, but here we are. Greetings, Phoenix

Sayonara, can you please stop bullshitting about representing DNA or protein sequences in a markup format? Thank you. Genetic engineering language? I doubt your protein renders are up to it! Just my 2 cents. Phoenix

Just a hint: you are still using IE! It's just a different GUI. It still has all the bugs @Sayonara: Firebird is one browser developed by the Mozilla project. Mozilla is a browser suite that is still being developed. However, most development effort in future will go into developing the browser and email (Thunderbird) components separately. They're easier to maintain that way than as an integrated package. Greetz, Phoenix

For all those who like IE and its fancy third-party front-ends in spite of the vulnerabilities, do try SlimBrowser. I've used it, liked it, and I think it tries to achieve similar things as MyIE2 (even though I haven't tried that one, after reading a magazine review that rated SlimBrowser higher than MyIE2). Greetz, Phoenix

on the original topic: the best prevention of extinction has often been diversification. Don't see any chance of that for us since we now interbreed globally without many remaining impediments, so based on correlative evidence, one should foresee doom. However, human beings are quite unlike any other species, and we have the chimps as backup. Just my two cents... Phoenix

Historical contingency is usually quite a winner. If your ancestors hadn't, by accident, got out of Africa, you wouldn't be sitting here asking this question! Greetz, Phoenix

Actually, genetic diversity of human beings is remarkably low compared to other species. The unusual sex chromosome combinations you mention are actually mostly sterile. That doesn't help survival of the species particularly. On the main topic of this thread: What is evolution? Are we talking about fixation of alleles or does change in allele frequency count as evolution, too? If the latter, it will be easy to observe even within centuries. Local or global - no matter. Think of selection for milk tolerance, or the relative explosion of, say, the Chinese as a proportion of the world's population. There are bound to be some unique alleles there that have different phenotypic effects. Regards, Phoenix PS: Maybe more important is the question - are we getting smarter? If not, then everything will slowly boil down to genetics. If we are getting smarter, genetic effects will become less important over time, and opportunities for learning will play an increasingly large role.

So is everybody else. Head on and do it! Greetz, Phoenix

I understood they had developed those pumps to help with ejaculation rather than erection, but I'll be glad to stand corrected! Phoenix