Sequence

In AP Biology we generally use syringes or 1ml pipettes, granted that we don't go for a high degree of accuracy, but the calculations work out.

In my Calculus class today we were discussing thermodynamics, and one person claimed that he has thought of a way to violate the laws of thermodynamics. His proposal goes like this. Water expands when it freezes, so as energy is released from water, and it freezes, the expansion could be harnessed to give more energy then you started with, so you get the energy that is released from the water, in addition to the energy generated by the movement of the water as it freezes. I don't have enough of a background in physics to counter this, could someone else help me to understand how this fits in with thermodynamics?

If they were advanced enough to have space travel theyd destroy us, however, like you said, they would probably intercept a tv broadcast and get the hell out of dodge for fear of being infected with stupidity.

alright, I think I got that.

thanks guys, I have another question though. Is there any force that is capable of fusing the electrons with the nucleus? I know this happens in neutron stars but is there any other force capable of doing it? Probly a simple question but I havn't taken much in the way of physics.

I fall into that first group. I'm sixteen and I know very little compared to most people here. But I listen when someone corects me. As long as they aren't a complete dickhead about it I'm more then happy to take critisicm and learn from it.

yeah it happens to me to, nothing big like car accidents. I'm really good at dodgeball because when I'm playing everything seems to slow down. Now that it's mentioned, I don't remember anything of it. Just doing it. No colors or feelings. Just instinct to not let the thing flying at me hit me.

I think evolution will slow down now, like it has for a while, but eventually somthing huge will happen. Then it will kick start again.

eh, my dogs dumb. He howls until you let him out.

We were talking about absolut in zero in chemistry last week and I thought of somthing, Absolut zero is the tempature at which molecules stop moving. What happens at the subatomic level? Do the electrons keep moving, or would they cease movement as well? If they do keep moving, would a theoretical temp. even colder then 0 k cause them to stop orbiting the nucleus and fall to the center?

well gravity is gravity, anyway, I was thinking about it in english and figured it wouldn't work. The ship would have to be a weird shape. shperical

That's ridiculous, I think spelling shouldn't put you down to much as long as you know the stuff but thats just not right.

A lot of the problems might be fixed with future technology. We don't have the tech now. We might in the future.

no you can't. Only 360 games and some old xbox games. I'd reccomend the 360. PS3 isn't bringing anything really new to the table, it's graphics are comparable to the 360. I'd say 360 or mabye a wii.

Would it be possible to have some sort of super dense material near the center of the ship to create a mini gravity field? I know it's highly unlikly but could it happen?

looks really interesting. I'm sure the martian wouldn't mind a little publicity. He's fairly vain you know....

GTCAGTCAGTCGTGTAGTCGATGCTAGCTACGTAGTAGCTACGTACGTAGCTACGTAGC TGTAGCTACGTAGCTAGTAGCTAGCTAGCTAGCTACGTACGATCGATGCTAGCATGCTG CTAGTCGTTTCTAGGCCCAGTAGTTTCAGGAGATCGAGGAGACTAGGAGGGACTAGGA TCGATCGATGAGTAGAGAGCTGCATGCGAGCAGCTAGGCATCGATCGTAGTGTCAAGT AAACTGCATGCGATCGATGCTATGACTAGTCGTGAGCATGTGCTTTTTTTAGCTAGCCC CAAAAACGATCGACGTCTATGTACGTACGTAGCGTAGTCGATCGGACTAGATGCTGCAT ACCACACATCGTGCATGCTGATGCTGATGCTAGCTAGCTAGCTAGCTGTAGCGACTAGCT BEAT THAT! jk by the way

How dare you all talk about political corectness like thatQ That's not Politically correct! Anyway, In my experiances, it's a way for any minority to get pissed about things.

I think the technology would go in the direction of cloning organs. It makes no sense to clone a human just to send them out into the world. But, if we could succefully clone organs, the donor list becomes non-excistent.

Could you use the centrifugal force generated by a spinning section of a ship to create a gravityesque force? Then have people spend as much time in that area as possible?

It's interesting either way. What's the limit of the speed of the wind? It can't keep getting faster forever can it?

since the topic has been brought back from the grave I'll chime in, They shouldn't call them dwarf planets because the word planets is in the name.

I also love bacon, pigs may be inteligent, but they are also delicious. Like the article said, The researchers also found people who ate bacon and other processed meats frequently were also more likely to smoke and to take in more fat and fewer vitamins. They were also less likely to exercise. It isn't just the bacon. It's just a factor.

Less genetic diseases. Hopefully Iran never weaponized their nuclear program and didn't blow somthing up.

just start a new one