erynna

Hi, I have been trying to find away of detecting if knot weed actually dead or just dormant. I have considered detecting for the presence or absence of mRNA (using the poly(A) tail) the idea being that mRNA will only be transcribed if the cells are still alive and functional. What do you think, do you think this is plausible or should I try to come up with something different Thanks, Erin

Hi, I recently completed and submitted my thesis and I have been thinking about seeing about getting it published. I have never even attempted anything like this and I was wondering how to go about it and what I could do to increase my chances? Thanks, Erin

Hi I recently ran a PCR and unfortunately I did not have any success. Just want to run over my protocol and my ideas to see if I’m heading in the right direction to get things running and to see if anyone has any suggestions on how they would attack this problem I extracted genomic DNA from plant leaves using a sigma Extract-N-Amp plant PCR kit (I have never used this kit before and I don’t know if anyone has had any success with it?). I stored the DNA at 4oC for 3 days before conducting the PCR. I ordered in a primer from sigma, using the following sequence: CCCAGCAACTGATCGCACAC (GC%=60%, Tmo=69.2) This primer is based on the universal rice primer (URP2R) used in the following paper. http://www.seoulin.co.kr/upload/biofiles/2003812115152.pdf I resuspended the primer using sterile water (sigma recommended using wither 1xTE buffer or sterile water). The primer was not resuspened until just before I used it. I made the following master mix: I made enough master mix to make 5x reactions (+10%) •55µl Extract-N-Amp reaction mixture (according to sigma this is: a 2x reaction mixture containing buffers, salts, dNTps and Taq polymerase. It uses JumpStart Taq antibody specific for hot start amplification, ill come back to that in a second) •8.8µl of the primer (to give a concentration of 0.8µM (the stock was 100µL) I used this concentration because it is what sigma recommended to use in this particular kit. There was only one primer (opposed to forward and reverse) so I doubled the concentration from 0.4µM to 0.8µM •24.2µl PCR water Added 16µl master mix and 4µl of the extracted DNA into a 0.5ml PCR tube. (repeated for all samples and controls) Fun the theromcycler using the following cycling conditions: 1 cycle Initial Denaturing 94oC of 3 min 35 cycles Denaturation 94oC for 1 min Annealing 64oC 1 min Extension 72oC 1 min 1 cycle Final Extension 72oC 10 min 1 Hold 4oC Indefinitely When I programmed the thermocycler it had an option for “hot start” which I did not use. Now I’m wondering whether this particular Taq needs the hot start option switched on? Once the cycle was finished I stored them at 4oC for 2 days until I ran the gel. The Gel showed that no product was produced at all, no even faint bands. Now, here are my thoughts. 1.The DNA extraction was unsuccessful. To test this I want to try a different protocol (not a kit), or perhaps some serial dilutions of the kit extract. I know there are dozens of DNA extractions techniques and I’m a little overwhelmed on where to start, so if anyone has a particular one that they preformed to used that they would be willing to share that would be great 2.The primer does not recognise the particular genomic plant extract that I chose. I ran the sequence through the NCIB genomic blast and did not get any hits at all which was concerning. It might be an idea to use the same samples used in the research paper to make sure the sequence is recognised by the primer 3.I’m concerned that I resuspened the primer with water instead TE buffer, even though the protocol said I could use either. 4.Re-run with the ‘hot start’ switched on as it may be required to activate Taq, but you would think the Initial Denaturing step would be adequate…. 5.Reduce the annealing temp 6.Decrease or increase the denaturing temp All the equipment was ordered (but unopened) when I started working here about 3 weeks ago. I would have liked to have started using primers and samples that are known to work together, but they did not seem to see the importance of doing his when trying to get PCR up and running, they just wanted to get on with it I guess and skip the dull part. If anyone has any comments or suggestions that would be fantastic.

i want one!

Has anyone had success using the Sigma Extract-N-Amp Plant PCR kit? My employer ordered this kit in before I started working and I’m not sure how successful it is. Does anyone have any experiences they can share? Erynna

I thought about using random primers but I believe they would not result in clear bands. It would be nice if the students are able to see slightly different bands for the different plant species. This is the paper on the use of universal rice primers. http://www.seoulin.co.kr/upload/biofiles/2003812115152.pdf I have considered trying these primers out but if someone knows of a primer that will yield similar results I’m open for suggestions. Thanks Erynna

Hi All I'm currently working in the UK designing practical classes for college students and I'm in need of some plant biotechnology advice. Would anyone be able to recommend me a universal plant primer to use in PCR? I'm not looking to amplify a specific gene or sequence but I'm having difficulties finding a primer which is appropriate. I have considered using a universal rice primer or a universal chloroplast primer. I just wish to demonstrate the procedure of PCR and DNA fingerprinting to the students. Erynna

i have experienced this as well, and its absolutely terrifying.

i use erynna for all my online things, my real name is erin

hi im 22 and have a bachelor of science majoring in molecular biotechnology. i'm currently in the last few months of my honors. im looking into the role of leptin in the development of polycystic ovarian syndrome (PCOS). so far it has been the most intense 8 months of my life. it has taken me this long just to develop a new leptin and soluble leptin receptor ELISAs. i have been looking for a site like this for a while. its nice to have people to bounce ideas off and read about what people in the same field are involved in. erynna

hey. i had been having problems with windows xp on my laptop so a friend of mine installed kubuntu 7.04 for me, and so far its running very nicely. The problem is that i'm now running openoffice on linux which endonote is not compatible with so i need to install a new reference manager. After a lot of research i have decided on bibus being a very new kubuntu user i have no idea how i go about installing bibus on my laptop. i found the site where the instructions are but they make no sense to me. could anyone give me some simple guidance in how to go about this? heres the link: http://bibus-biblio.sourceforge.net/wiki/index.php/Installation#Debian_and_Ubuntu thanks erynna

hello. i have been working on developing a new leptin and leptin receptor ELISA as part of my honours project, and after 8 months of development i have finally gotten them to work. i have been having a lot of trouble finding the exact amino acid sequence of the peptides i have been using. can anyone direct me to a good online database i can use? thanks Erynna