Hi,
What I'm talking about is a language to describe biological problems & implement solutions. Some biological functionalities will be implemented in the core of the language. This is a glimpse of what I'm talking about :
begin {
mRNA m = "AUGAACGCCAUUUUUGAUGGGCCCUAA";
Protein p = m.transcript();
Cell_T4 t4;
out("Name : ", p.name, newl, "Code : ", p.code, newl, "Sequence : ", p.sequence);
if (t4.connect(p) = true)
out("T4 have receptors to protein ", p.name);
else
out("T4 don't have receptors to protein ", p.name);
m.mutate("UUU", "UGC");
end }
This code :
- Creates an mRNA strand and assign a value to it,
- Transcripts that mRNA into a protein and assign the result to a variable of type Protein,
- Creates a T4 cell,
- Prints protein information : name, code & sequence (newl stands for new line),
- Checks if the protein connects to any T4 cell receptor and prints out a message,
- Mutates the previous mRNA by interchanging the UUU codon by UGC codon,
I hope you got my point ...
