boa

Ok, so I tried to make primers according to gene X... so for the forward primer(oligo 1) I have : 5-ATGGAACATGTTTACTCCA-3 and for the reverse primer (oligo 2) : 5-TTAAACGCTGCTACTGCTGT-3 Am i doing this right? Also, how do I include the his tag? I dont understand what the c terminus thing is about... Thanks!

Thanks for your help CharonY. So since sau3a cuts beofre g, i believe my overhangs would be 5- (space) GATC-3 3-CTAG (space) -5 But i dont understand how this helps me to solve the problem...

I have no clue where to start but I think it is safe to say that my forward primer could be TAC and my reverse primer TTA (complementary sequences of the start and stop codon) but I dont know what to do after...the problem seems very overwhelming to me! I would like someone to provide me some hints to tackle this! Thanks everyone!Thank you for your help! Question : Write the sequence of two oligonucleotides that will allow you to clone the coding region of gene x in the vector pQE60 using PCR . The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present at the C-terminus of your recombinant protein. The oligos must be as short as possible but must hybridize with 20 nucleotides of the template sTrand. The start and stop codons of gene X are underlined. Coding sequence of gene X GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT Oligo #1 5' ________________________________________… Oligo #2 5' ________________________________________… Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG Additional Details The start and stop codons of gene X are the first ATG and the last TAA underlined in vector pqe60: the first ATG ---- I have no clue where to start but I think it is safe to say that my forward primer could be TAC and my reverse primer TTA (complementary sequences of the start and stop codon) but I dont know what to do after...the problem seems very overwhelming to me! I would like someone to provide me some hints to tackle this! Thanks everyone!

Hello all, I have absolutely no clue how to start this problem and I would like to have some cues or just something to chew on...thank you!! I know what a plasmid is , I know what sticky ends (cohesive extremities) are but I dont know how the multiple cloning sites in this plasmid are located so im a bit lost! Question: U must clone a DNA fragment having Sau3A sticky ends. The plasmid to be used for the cloning experiment has the following MCS EcoR1, BamH1, Xba1, HindIII *Describe how you would do the cloning experiment. Restriction enzyme recognition sites EcoR1 = GAATTC (the enzyme cuts after the G) BamH1 = GGATTC (the enzyme cust after the first G) Xba1 = TCTAGA (the enzyme cuts after the first T) HindIII = AAGCTT (the enzyme cuts after the first A) Sau3A = GATC (the enzyme cuts before the G)