PCR primer design question?

[metalgear21]

Anyone help me with this primer design question? I have searched everywhere on the internet but cant seem to get everything I need. So far I understand that

https://imgur.com/a/PfwAhO0

Forward primer is:

1. Restriction enzyme

2. start codon

3. Tag

4. Primer 20 bases from sequence of gene

                   EcoRI       Strep tag                                                                                                Primer 20 bases of gene

So I got 5' GAATTC ATGGCCTCGTGGTCGCATCCGCAGTTCGAGAAGTCGGGGGTG ATGCGGCTCTGCATCCCGCA 3'

Reverse primer is:

1. Restriction enzyme

2. Tag

3. Primer compliment of 20 bases from end of gene

4. Stop codon

                    BamHI      Hexa Histidine tag              Primer                                      stop codon

So I got 3' GGATCC GTGGTGGTGGTGGTGGTG TGCACCAGCCGCACAATGAATAA 5'

I know this is not correct. Is the question asking for two sets of primers considering it gives two restriction enzymes? Are the restriction enzyme recognition sites that are given supposed to be in the gene sequence in the question because I cant find them in it? Also which start and stop codon do you use in the gene sequence as there is multiple ones of both?  Any help or guidance would be greatly appreciated as this topic is driving me mad  

[BabcockHall]

Do you understand the purpose of the question?  In other words, do you know why someone would want to go into the laboratory to do this?  Do you know something about PCR mutagenesis?

[metalgear21]

I understand that primers need to be designed with specific requirements depending on the DNA template that's being amplified. I know what a primer does, it anneals to the single stranded DNA molecules after denaturation to allow polymerase to synthesize a new DNA strand. I dont know much about mutagenesis only that Mutagenesis involves incorporating a mutation into the DNA such as by a mismatching base used on the primer. I just dont fully understand the rules when it comes to designing the primers. 

[BabcockHall]

You have answered a different question from the one I intended to ask.  My educated guess is that this assignment presumes that one's purpose is to produce and purify a large quantity of this serotonin receptor.  That explains why one would want a start codon, a hexahistidine tag, etc.  BTW there is only one true start codon for a gene.   As for the problem itself, do you think that one could add restriction sites into a piece of DNA as part of the process of amplifying it via PCR?  If so, how?

 Assuming that one wished to amplify the gene for this receptor, how many primers would you need?