Jump to content

longest word


Guest adman77

Recommended Posts

Guest adman77

(1,185) Acetyl*seryl*tyrosyl*seryl*iso*leucyl*threonyl*seryl*prolyl*seryl*glutaminyl*phenyl*alanyl*valyl*phenyl*alanyl*leucyl*seryl*seryl*valyl*tryptophyl*alanyl*aspartyl*prolyl*isoleucyl*glutamyl*leucyl*leucyl*asparaginyl*valyl*cysteinyl*threonyl*seryl*seryl*leucyl*glycyl*asparaginyl*glutaminyl*phenyl*alanyl*glutaminyl*threonyl*glutaminyl*glutaminyl*alanyl*arginyl*threonyl*threonyl*glutaminyl*valyl*glutaminyl*glutaminyl*phenyl*alanyl*seryl*glutaminyl*valyl*tryptophyl*lysyl*prolyl*phenyl*alanyl*prolyl*glutaminyl*seryl*threonyl*valyl*arginyl*phenyl*alanyl*prolyl*glycyl*aspartyl*valyl*tyrosyl*lysyl*valyl*tyrosyl*arginyl*tyrosyl*asparaginyl*alanyl*valyl*leucyl*aspartyl*prolyl*leucyl*isoleucyl*threonyl*alanyl*leucyl*leucyl*glycyl*threonyl*phenyl*alanyl*aspartyl*threonyl*arginyl*asparaginyl*arginyl*isoleucyl*isoleucyl*glutamyl*valyl*glutamyl*asparaginyl*glutaminyl*glutaminyl*seryl*prolyl*threonyl*threonyl*alanyl*glutamyl*threonyl*leucyl*aspartyl*alanyl*threonyl*arginyl*arginyl*valyl*aspartyl*aspartyl*alanyl*threonyl*valyl*alanyl*isoleucyl*arginyl*seryl*alanyl*asparaginyl*isoleucyl*asparaginyl*leucyl*valyl*asparaginyl*glutamyl*leucyl*valyl*arginyl*glycyl*threonyl*glycyl*leucyl*tyrosyl*asparaginyl*glutaminyl*asparaginyl*threonyl*phenyl*alanyl*glutamyl*seryl*methionyl*seryl*glycyl*leucyl*valyl*tryptophyl*threonyl*seryl*alanyl*prolyl*alanyl*serine

Link to comment
Share on other sites

who needs theoretical, the IUPAC name of human DNA would fill several libraries.

 

That would be interesting too see; one for every person on the planet would be a hell of a lot of books! They can't even agree on a name for a semi-complex compound so they have little hope of ever getting a name (nor would they want too I hope!)

Link to comment
Share on other sites

well, this is where digital storage comes into its own. when you can shove a couple of libraries in a surprisingly small box.

 

Good point (with those new HDD disks in the making we are talking serious storage in a really small place already).

 

Could it be named by hand? No. Do we have the processing power capable of naming a full DNA strand? Probably but who would waste their time? Still, I'd love to see it ;)

Link to comment
Share on other sites

GTCAGTCAGTCGTGTAGTCGATGCTAGCTACGTAGTAGCTACGTACGTAGCTACGTAGC

TGTAGCTACGTAGCTAGTAGCTAGCTAGCTAGCTACGTACGATCGATGCTAGCATGCTG

CTAGTCGTTTCTAGGCCCAGTAGTTTCAGGAGATCGAGGAGACTAGGAGGGACTAGGA

TCGATCGATGAGTAGAGAGCTGCATGCGAGCAGCTAGGCATCGATCGTAGTGTCAAGT

AAACTGCATGCGATCGATGCTATGACTAGTCGTGAGCATGTGCTTTTTTTAGCTAGCCC

CAAAAACGATCGACGTCTATGTACGTACGTAGCGTAGTCGATCGGACTAGATGCTGCAT

ACCACACATCGTGCATGCTGATGCTGATGCTAGCTAGCTAGCTAGCTGTAGCGACTAGCT

 

BEAT THAT!

 

jk by the way

Link to comment
Share on other sites

technically, theoretical molecules can give you longer words than even that.

 

HOW?!

 

Is it just how their naming conventions are arranged?:confused:

 

who needs theoretical, the IUPAC name of human DNA would fill several libraries.

 

See above.

 

Linky?

Link to comment
Share on other sites

HOW?!

 

Is it just how their naming conventions are arranged?:confused:

 

in theory, you could just keep adding functional groups and making the molecule name longer. Technically, there would be no upper limit to the size of the molecule, and the name of the compound. Obviously, physical laws don't actually allow for this to occur in nature.

Link to comment
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
×
×
  • Create New...

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.