Guest adman77 Posted December 5, 2006 Share Posted December 5, 2006 (1,185) Acetyl*seryl*tyrosyl*seryl*iso*leucyl*threonyl*seryl*prolyl*seryl*glutaminyl*phenyl*alanyl*valyl*phenyl*alanyl*leucyl*seryl*seryl*valyl*tryptophyl*alanyl*aspartyl*prolyl*isoleucyl*glutamyl*leucyl*leucyl*asparaginyl*valyl*cysteinyl*threonyl*seryl*seryl*leucyl*glycyl*asparaginyl*glutaminyl*phenyl*alanyl*glutaminyl*threonyl*glutaminyl*glutaminyl*alanyl*arginyl*threonyl*threonyl*glutaminyl*valyl*glutaminyl*glutaminyl*phenyl*alanyl*seryl*glutaminyl*valyl*tryptophyl*lysyl*prolyl*phenyl*alanyl*prolyl*glutaminyl*seryl*threonyl*valyl*arginyl*phenyl*alanyl*prolyl*glycyl*aspartyl*valyl*tyrosyl*lysyl*valyl*tyrosyl*arginyl*tyrosyl*asparaginyl*alanyl*valyl*leucyl*aspartyl*prolyl*leucyl*isoleucyl*threonyl*alanyl*leucyl*leucyl*glycyl*threonyl*phenyl*alanyl*aspartyl*threonyl*arginyl*asparaginyl*arginyl*isoleucyl*isoleucyl*glutamyl*valyl*glutamyl*asparaginyl*glutaminyl*glutaminyl*seryl*prolyl*threonyl*threonyl*alanyl*glutamyl*threonyl*leucyl*aspartyl*alanyl*threonyl*arginyl*arginyl*valyl*aspartyl*aspartyl*alanyl*threonyl*valyl*alanyl*isoleucyl*arginyl*seryl*alanyl*asparaginyl*isoleucyl*asparaginyl*leucyl*valyl*asparaginyl*glutamyl*leucyl*valyl*arginyl*glycyl*threonyl*glycyl*leucyl*tyrosyl*asparaginyl*glutaminyl*asparaginyl*threonyl*phenyl*alanyl*glutamyl*seryl*methionyl*seryl*glycyl*leucyl*valyl*tryptophyl*threonyl*seryl*alanyl*prolyl*alanyl*serine Link to comment Share on other sites More sharing options...
ecoli Posted December 5, 2006 Share Posted December 5, 2006 technically, theoretical molecules can give you longer words than even that. Link to comment Share on other sites More sharing options...
insane_alien Posted December 5, 2006 Share Posted December 5, 2006 who needs theoretical, the IUPAC name of human DNA would fill several libraries. Link to comment Share on other sites More sharing options...
TOAWNIF Posted December 6, 2006 Share Posted December 6, 2006 In my experience the longest word is Why? :mad: Link to comment Share on other sites More sharing options...
ecoli Posted December 6, 2006 Share Posted December 6, 2006 In my experience the longest word is Why? :mad: gloriously philosophical. Link to comment Share on other sites More sharing options...
RyanJ Posted December 6, 2006 Share Posted December 6, 2006 who needs theoretical, the IUPAC name of human DNA would fill several libraries. That would be interesting too see; one for every person on the planet would be a hell of a lot of books! They can't even agree on a name for a semi-complex compound so they have little hope of ever getting a name (nor would they want too I hope!) Link to comment Share on other sites More sharing options...
insane_alien Posted December 6, 2006 Share Posted December 6, 2006 well, this is where digital storage comes into its own. when you can shove a couple of libraries in a surprisingly small box. Link to comment Share on other sites More sharing options...
RyanJ Posted December 6, 2006 Share Posted December 6, 2006 well, this is where digital storage comes into its own. when you can shove a couple of libraries in a surprisingly small box. Good point (with those new HDD disks in the making we are talking serious storage in a really small place already). Could it be named by hand? No. Do we have the processing power capable of naming a full DNA strand? Probably but who would waste their time? Still, I'd love to see it Link to comment Share on other sites More sharing options...
insane_alien Posted December 6, 2006 Share Posted December 6, 2006 scrolling through it would probably take a few years in itself. Link to comment Share on other sites More sharing options...
RyanJ Posted December 6, 2006 Share Posted December 6, 2006 Probably and I'd also like to find someone that could say the thing! Now that would be a feat worthy of recognition. Link to comment Share on other sites More sharing options...
insane_alien Posted December 7, 2006 Share Posted December 7, 2006 it could be the new memorizing pi to the nth number fad. who can remember their own DNA sequence to the most base pairs. Link to comment Share on other sites More sharing options...
Sequence Posted December 8, 2006 Share Posted December 8, 2006 GTCAGTCAGTCGTGTAGTCGATGCTAGCTACGTAGTAGCTACGTACGTAGCTACGTAGC TGTAGCTACGTAGCTAGTAGCTAGCTAGCTAGCTACGTACGATCGATGCTAGCATGCTG CTAGTCGTTTCTAGGCCCAGTAGTTTCAGGAGATCGAGGAGACTAGGAGGGACTAGGA TCGATCGATGAGTAGAGAGCTGCATGCGAGCAGCTAGGCATCGATCGTAGTGTCAAGT AAACTGCATGCGATCGATGCTATGACTAGTCGTGAGCATGTGCTTTTTTTAGCTAGCCC CAAAAACGATCGACGTCTATGTACGTACGTAGCGTAGTCGATCGGACTAGATGCTGCAT ACCACACATCGTGCATGCTGATGCTGATGCTAGCTAGCTAGCTAGCTGTAGCGACTAGCT BEAT THAT! jk by the way Link to comment Share on other sites More sharing options...
insane_alien Posted December 8, 2006 Share Posted December 8, 2006 i have the sequence GATTACA 7 times in my DNA lets see who gets this one. Link to comment Share on other sites More sharing options...
JTM³ Posted December 14, 2006 Share Posted December 14, 2006 technically, theoretical molecules can give you longer words than even that. HOW?! Is it just how their naming conventions are arranged? who needs theoretical, the IUPAC name of human DNA would fill several libraries. See above. Linky? Link to comment Share on other sites More sharing options...
ecoli Posted December 14, 2006 Share Posted December 14, 2006 HOW?! Is it just how their naming conventions are arranged? in theory, you could just keep adding functional groups and making the molecule name longer. Technically, there would be no upper limit to the size of the molecule, and the name of the compound. Obviously, physical laws don't actually allow for this to occur in nature. Link to comment Share on other sites More sharing options...
Sisyphus Posted December 14, 2006 Share Posted December 14, 2006 Technical words shouldn't count, since they can just be indefinitely large. The longest non-technical, non-proper noun, non-joke (a word created specifically to be long) word in the English language is floccinaucinihilipilification. See: http://en.wikipedia.org/wiki/Longest_word Link to comment Share on other sites More sharing options...
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now