PCR Advice and comments

[erynna]

Hi

I recently ran a PCR and unfortunately I did not have any success. Just want to run over my protocol and my ideas to see if I’m heading in the right direction to get things running and to see if anyone has any suggestions on how they would attack this problem

 

I extracted genomic DNA from plant leaves using a sigma Extract-N-Amp plant PCR kit (I have never used this kit before and I don’t know if anyone has had any success with it?). I stored the DNA at 4oC for 3 days before conducting the PCR.

 

I ordered in a primer from sigma, using the following sequence: CCCAGCAACTGATCGCACAC (GC%=60%, Tmo=69.2)

 

This primer is based on the universal rice primer (URP2R) used in the following paper. http://www.seoulin.co.kr/upload/biofiles/2003812115152.pdf

 

I resuspended the primer using sterile water (sigma recommended using wither 1xTE buffer or sterile water). The primer was not resuspened until just before I used it.

 

I made the following master mix: I made enough master mix to make 5x reactions (+10%)

•55µl Extract-N-Amp reaction mixture (according to sigma this is: a 2x reaction mixture containing buffers, salts, dNTps and Taq polymerase. It uses JumpStart Taq antibody specific for hot start amplification, ill come back to that in a second)

•8.8µl of the primer (to give a concentration of 0.8µM (the stock was 100µL) I used this concentration because it is what sigma recommended to use in this particular kit. There was only one primer (opposed to forward and reverse) so I doubled the concentration from 0.4µM to 0.8µM

•24.2µl PCR water

 

Added 16µl master mix and 4µl of the extracted DNA into a 0.5ml PCR tube. (repeated for all samples and controls)

 

Fun the theromcycler using the following cycling conditions:

 

1 cycle

Initial Denaturing 94oC of 3 min

 

35 cycles

Denaturation 94oC for 1 min

Annealing 64oC 1 min

Extension 72oC 1 min

 

1 cycle

Final Extension 72oC 10 min 1

 

Hold 4oC Indefinitely

 

When I programmed the thermocycler it had an option for “hot start” which I did not use. Now I’m wondering whether this particular Taq needs the hot start option switched on?

 

Once the cycle was finished I stored them at 4oC for 2 days until I ran the gel. The Gel showed that no product was produced at all, no even faint bands.

 

Now, here are my thoughts.

1.The DNA extraction was unsuccessful. To test this I want to try a different protocol (not a kit), or perhaps some serial dilutions of the kit extract. I know there are dozens of DNA extractions techniques and I’m a little overwhelmed on where to start, so if anyone has a particular one that they preformed to used that they would be willing to share that would be great

2.The primer does not recognise the particular genomic plant extract that I chose. I ran the sequence through the NCIB genomic blast and did not get any hits at all which was concerning. It might be an idea to use the same samples used in the research paper to make sure the sequence is recognised by the primer

3.I’m concerned that I resuspened the primer with water instead TE buffer, even though the protocol said I could use either.

4.Re-run with the ‘hot start’ switched on as it may be required to activate Taq, but you would think the Initial Denaturing step would be adequate….

5.Reduce the annealing temp

6.Decrease or increase the denaturing temp

 

All the equipment was ordered (but unopened) when I started working here about 3 weeks ago. I would have liked to have started using primers and samples that are known to work together, but they did not seem to see the importance of doing his when trying to get PCR up and running, they just wanted to get on with it I guess and skip the dull part.

 

If anyone has any comments or suggestions that would be fantastic.

[Blazenarrow]

well first off, what was the problem? Did you run it through a gel to see if you were able to amplify any DNA??

[MedGen]

Hi

I recently ran a PCR and unfortunately I did not have any success. Just want to run over my protocol and my ideas to see if I’m heading in the right direction to get things running and to see if anyone has any suggestions on how they would attack this problem

 

I extracted genomic DNA from plant leaves using a sigma Extract-N-Amp plant PCR kit (I have never used this kit before and I don’t know if anyone has had any success with it?). I stored the DNA at 4oC for 3 days before conducting the PCR.

 

I ordered in a primer from sigma, using the following sequence: CCCAGCAACTGATCGCACAC (GC%=60%, Tmo=69.2)

 

That's a very high GC content and Tm. Its always worth using a primer calculator when designing primers. I personally use the nearest-neighbour Tm as a guide for annealing temps. You want a GC% around 50%, just because it simplifies the reaction. High GC content 60+ often requires a specifically optimised reaction buffer.

 

I made the following master mix: I made enough master mix to make 5x reactions (+10%)

•55µl Extract-N-Amp reaction mixture (according to sigma this is: a 2x reaction mixture containing buffers, salts, dNTps and Taq polymerase. It uses JumpStart Taq antibody specific for hot start amplification, ill come back to that in a second)

•8.8µl of the primer (to give a concentration of 0.8µM (the stock was 100µL) I used this concentration because it is what sigma recommended to use in this particular kit. There was only one primer (opposed to forward and reverse) so I doubled the concentration from 0.4µM to 0.8µM

•24.2µl PCR water

 

Added 16µl master mix and 4µl of the extracted DNA into a 0.5ml PCR tube. (repeated for all samples and controls)

 

I always add one extra reaction when making up a master mix, it allows for a larger margin or error when pipetting between several different tubes.

 

If you only use one primer then you will only get linear amplification, you'll need a reverse primer for exponential amplification.

 

Its worth checking with the supplier of the PCR kit (website and protocol supplied) for optimum reaction conditions and reagent concentrations. Generally speaking I work with primers at 100µM each and dNTP's at 10mM. That usually means that most of the reagents get used up but don't become rate limiting in later cycles.

 

Standardise your reaction volume, say 20, 25 or 50µl. That way it makes it easier to calculate concentrations and hence the required volume. Always calculate the water requirements last as this effectively just provides a medium for the reaction to occur in. Calculate what you need for one reaction, then multiply up to the number of reactions you are carrying out, it makes the whole process easier.

 

Fun the theromcycler using the following cycling conditions:

 

1 cycle

Initial Denaturing 94oC of 3 min

 

35 cycles

Denaturation 94oC for 1 min

Annealing 64oC 1 min

Extension 72oC 1 min

 

1 cycle

Final Extension 72oC 10 min 1

 

Hold 4oC Indefinitely

 

Work on the basis of the recommended thermal profile supplied by the manufacturer, they are optimised for that enzyme. To get the annealing temp you'll need to run an annealing temperature gradient, it will be a function you can programme on your thermal cycler. Your steps seem long. Generally the initial denaturing last for no more than a minute, depending on the extraction product size and target sequence length. The same applies to the annealing time, only needs to be around 5-30 secs.

The extension time depends on the length of your intended amplicon. The longer it is the longer you need to run the extension time. The protocol provided with your enzyme should give a guide of the processivity, generally stated as bp(or kb)/s. e.g. you need a product of 4kb and the processivity is 1kb/30s, run the extension for 2 mins and then a little more, say 5-10 secs.

 

The final extension time is usually 5-10 mins just to finish off the final cycle so all the sequences are the right length.

 

Bare in mind when setting up the thermal profile that although the polymerase is thermostable, it doesn't mean it is indestructible, it still needs to be stored in -20 freezer, and on ice when being used. Additionally the repeated thermal cycling will denature the enzyme slowly.

 

The annealing temp gradient needs to be designed on the basis of the nearest-neighbour Tm. I generally go up and down by 6 degree with the calculated Tm in the middle. e.g. my Tm is 59oC, so I'll set up a temp gradient of 53oC to 65oC.

 

When I programmed the thermocycler it had an option for “hot start” which I did not use. Now I’m wondering whether this particular Taq needs the hot start option switched on?

 

If you have a hot-start enzyme then start the reaction with a hot-start, it will increase the specificity of the reaction and prevent unwanted non-specific amplification

 

If anyone has any comments or suggestions that would be fantastic.

 

Hope that helps resolve your problems. Also when designing primers always have your target sequence in front of you, and if you want to sequence a particular region then you need to shift your primers up/downstream accordingly to account for interference from the dyes.

[Tekmo]

First, check your sequence. It's really important that you know where your primer binds for several reasons:

 

1. You know if you will get undesired products (maybe it binds in more than one place or has a lot of similar binding sites)

2. You know what size band to expect

3. You know how long to run the extension part of the cycle (based on the amplified product length)

 

I don't know why you only use a single primer unless it binds in two sites that are on opposite strands and face each other. PCR won't amplify exponentially unless you are copying both strands of the template.

 

Also, I don't know how much DNA is typically produced from plant extraction, but if it normally produces a lot you could run that dna extract on a gel just to see if the extraction worked. But it is more likely that the PCR failed, since PCR (in theory) only needs a single strand of the template DNA present to work.

 

Also, it's generally a good idea to always design your primers yourself. There are a lot of mistakes you can make with designing primers (I know I've made plenty of those mistakes) and designing them yourself will help you learn to catch potential problems early on. It's best to ask somebody you are working with for help with this but here's a good place to start if you wanted to do some learning on your own:

 

http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html

[ecoli]

try setting up a gradient PCR, if you have the right machine, to check for the optimal annealing temperature.

[Violetearth]

If you are just testing PCR capacity, perhaps you could get a plasmid that comes with standard primers and run it with your protocol. Someone in another lab would likely loan you the minute amounts you would need. In fact, if you tell them what you are doing, they might give you primers and DNA that they know will work.

 

In response to your thoughts:

1. The DNA extraction was unsuccessful.

- You can test your extraction by quantifying the resulting DNA at 260 nm on a spectrometer, or

- You can cut some DNA with a high frequency cutting plasmid and run the DNA on a gel next to a marker that allows you to quantify your DNA yield. This is a bit barbaric, but effective for a yes/no answer.

 

2.The primer. I agree with the previous post. This may be the first thing to check. If your sequence does not match anything in the genome or if it only primes in one direction, you will not get amplification. You should find two primer-appropriate genomic sequences that flank a gene of interest. One should run 3' to 5' and other should run 5' to 3' so that bases are added across the gene of interest.

 

3.Water not TE. Sterile, de-ionized water works beautifully for resuspending primers. This is not a concern.

 

4.Hot start

Hot start means that instead of the standard 2 - 3 minute denaturing temperature, your first PCR cycle has a 10ish minute denaturing cycle. This is bad for your regular Taq. You can manually hot start by adding your Taq to the reaction at the 7 minute stage so it is only in the heat 2 - 3 minutes. This can greatly increase the amount of product you get from your reaction.

 

5.Reduce the annealing temp

Probably not. Your primer is GC rich and should anneal if it has a mate in the genome.

 

6.Decrease or increase the denaturing temp. Increase it if the genome of your species is extremely GC rich. Otherwise, you're probably okay.