DNA\RNA coding

[alan2here]

I'm interested in computer science. I like all sorts of programming, from various programming langueges to the more unusual such as Cellular Automation (not to do with biological cells). Iv'e seen videos like this one, TED talks is also good for this sort of thing.

 

http://video.google.co.uk/videoplay?docid=-6950604815683841321&ei=UZGNSommHoaJ-Ab2g4X0CA&q=dna+hacking&hl=en

 

Can I get some information about what information transfer, storege of and acess to state and computation occurs allong the a DNA or RNA for what set of the four letters occur along the strand.

 

To reduce the complication of this question we could presume the strand is 1D and ignore instructions that cause the NA to construct or interact with other strands.

 

Iv'e posted this in computer science as I want to aproach this question from a coding (any sence of the word, not just syntactic languages) point of view.

Edited August 27, 2009 by alan2here

[Xittenn]

The four letters are used in coding for what amino acid to insert into a peptide sequence when RNA is read during protein synthesis by the ribosomes.

 

http://en.wikipedia.org/wiki/Genetic_code

 

 

 

To reduce the complication of this question we could presume the strand is 1D and ignore instructions that cause the NA to construct or interact with other strands.

 

Just out of curiosity where was this statement intending to lead?

---

Merged post follows:

Consecutive posts merged

Would this be an accepted context-free language or would some argue the opposition?

Edited September 1, 2009 by buttacup

[alan2here]

Just out of curiosity where was this statement intending to lead?

 

Because as Iv'e seen it you can code them on there own to perform computations for example logic gates and the such and you use a single line of text, although in reality they are not 1D they are double helixed (curly) that complication can probbably be abstracted out when thinking only about how to code them.

 

Simmerlarly they must be able to construct, replicate, break apart, join up with other parts of themselves and the such. Although thease functions are probbably even more complicated to understand than the basic concepts of how to code them.

 

Therefore at first I thought it would be most usefull to focus of the storing of state and computation along one line imagining it as being a 1D line.

---

Merged post follows:

Consecutive posts merged

Would this be an accepted context-free language

I clearly don't have any controll over how the languege works although components could be designed to work together nicely or not. Additionally a 2 level, a higher level code could be writtain and then converted to the 2Bit languege of life. Tell me more about what you meant. Edited September 1, 2009 by alan2here
Consecutive posts merged.

[Xittenn]

although in reality they are not 1D they are double helixed (curly)

 

I took this as meaning D + NA = DNA, I didn't see the link to 1 dimensional space.

 

As for the second bit it was just an observation on this subject with regards to another thread(I may have intended a little humour.)

 

This one!

Edited September 1, 2009 by buttacup

[alan2here]

I know we can sequence DNA in both directions and single celled lifeforms have been created that allow DNA to be implanted into them and they then turn into the lifeform described in the DNA.

 

I don't know however how far allong we are in RNA but I understand that it has much of the same sorts of processing power.

 

So in saying NA I was just refering to either.

 

This is from a purly computational point of view though, I have no lab in which to do the practical things myself.

[baxtonduglonn]

I have no lab in which to do the practical things myself.

 

When it comes to DNA, the "practical things" are usually done in bed, not in the lab.

 

Seriously, with a four member sequential code, it should be easy to program; the difficult part is assessing how each pair relates to other pairs in combination.

I know considerable progress has been made in this field, e.g. the gene responsible for achondroplasia, the form of dwarfism my wife has, was identified in 1994.

 

When it becomes possible for two individuals to enter their DNA sequences into a computer and get a prediction of the likely characteristics and defects of potential offspring, then we enter the realm of "designer babies" and the ethical dilemmas that will pose.

[alan2here]

With a four member sequential code, it should be easy to program; the difficult part is assessing how each pair relates to other pairs in combination.

Thank you.

 

What do you mean by pair?

 

Take a small strand of RNA.

 

"UUAU"

 

I mean by 2bit that there are 2^2 = 4 possible states for each nucleotide.

 

You might mean that each group of 2 work together somehow.

 

"[uU][AU]"

 

But I suspect you mean that two NA's have to be compaired to each other, or is this just for RNA because DNA is already duell stranded? although that dosn't make to much sence because both strands are the same in DNA.

 

"UUAU"

"UAUA"

 

So if this is the case would it be some sort of substitution rule, possibly starting at one end or simultaneously?

 

For example left to right

 

"UA"

"AU"

 

becomes

 

"AU"

"UA"

 

therefore

 

"UUAU"

"UAUA"

 

...

 

"UUUA"

"UAAU"

 

... (back to start)

 

(program will no longer change)

[Xittenn]

RNA codes for proteins. Sets of three nucleotides or tri-nucleotide sets represent an amino acid to be entered into the chain. There are, in combination, 64 possible codons in RNA! These do have degeneracies. Of these 64 codons 3 are stop codes. AUG which codes for Methionine is also the start codon.

 

so like [math] 4^3 [/math]

 

and

 

http://en.wikipedia.org/wiki/Genetic_code <= has a lot of information

---

Merged post follows:

Consecutive posts merged

I've never seen it formatted like this before:

 

 

 

http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=cgencodes#SG1

Edited September 6, 2009 by buttacup
Consecutive posts merged.

[alan2here]

RNA codes for proteins. Sets of three nucleotides or tri-nucleotide sets represent an amino acid to be entered into the chain. There are, in combination, 64 possible codons in RNA! These do have degeneracies. Of these 64 codons 3 are stop codes. AUG which codes for Methionine is also the start codon.

As I understand it from you and the article in RNA the sequence is divided into groups of 3 for which it is practical to think of as 3 parallel sequences so you can think of each triplet as a unit of 64 states whereas in DNA each part is seperate?

 

It also seems you are saying that RNA must start.

 

AUG etc...

 

Or to put it (a better?) way.

 

A etc...

U etc...

G etc...

 

I'm persuming in lack of other information that the RNA is read left to right and jumping back to the left is possible though some sequance.

 

The article also says smart-ass coders or highly efficent lifeforms could use 3 different programs for the 3 offsets known as reading frames.

 

It says that mRNA requires AUG to show the start of the section to be read. mRNA seems to be to do with transfering information inside a cell containing DNA as well, is this the same RNA that can be found in a virus?

 

There is a nice table of commands that can be sumerised as.

 

Go

Stop

Chemical

 

There is a command to perform encode on an emino acid? Are the chemical comands all encoding the chemicals listed and what does this mean?

 

 

Reguarding DNA, the most relevent seeming article is verry short.

http://en.wikipedia.org/wiki/DNA_sequence

Edited September 7, 2009 by alan2here

[Xittenn]

RNA is transcribed from DNA in a process known as transcription. It is in fact a one to one process. DNA just stores the code and RNA is more like the code in action. I'm not sure what you think DNA itself does or why this seems to be your primary focus. If you are coding a language that is quasi equivalent to human genetics you should moreso be looking at RNA and how Ribosomes process them to produce proteins. Some viral contagions require no RNA to reproduce but this is because they infect a host with their DNA and allow the host to procreate for them(T4 Bacteriophage.)

[alan2here]

Much of the media I have seen is about sequencing DNA, so you start with some DNA from a cell, read it, then implant it into a specal cell that morphs itself to become as the DNA instructs.

 

It also says that for example one can change some letters from DNA of a lifeform that equate to a behaviour and replace it with some of your own then compile the life form using this special cell and that sequences of DNA letters can be used to create functions that are purly computational such as "a ring oscillator" and "logic gates" for others to put together to create fully functioning lifeforms. So the idea behind my languege was just the computational parts of DNA to work on such stuff without the lab or as they usually describe it sending off computer disks and getting bactera back.

 

Iv'e never heard the tearm RNA sequencing and you say that DNA uncompressed into RNA to execute. So it much therefore be the case that they work with DNA because they can and it usefully turns into RNA which acts as you have coded it to.

 

Are there any RNA commands (to disguard) that can not be constructed from decompressed DNA?

 

If some viruses have no RNA and DNA does not compute just turns into usefull RNA then how do they function, grow, find cells to invade etc..?

[CharonY]

Actually you should just start off reading a few articles (even Wikipedia) about DNA and RNA and the very basics. The problem is that you base your assumptions on a very inaccurate guesstimations and any info given right now will probably just lead to confusion at best.

[alan2here]

I've read the wiki pages that are linked in this thread which I understand more parts of each time I re-read them.

 

If I don't get your answers to some of my yet unanswered questions at first I don't mind, I can research and ask relevent questions untill I understand what you mean.

 

At 29:34 this part is shown

 

TAATACGACTCACTATAGGGAGA = Promoter

 

The next slide then mearly shows "Promoter" followed by another part name instead of all the letters indevidually because then it would be a confusingly long string.

 

I understand what your saying I just need some more smaller level details about what happens.

 

I don't know what a "promoter" (or what the RNA transcribed (copied and adjusted\decompressed) from the DNA string above) does. If I knew what a "TAAT" did for example then I might be able to figure it out.

 

If I knew assembly language and wanted to teach you then I wouldn't need to start with the molecular makeup of semiconductors, the mechanics of transistors or the electric flow inside printed circuits, although this is clearly different perhaps not too different.

Edited September 11, 2009 by alan2here

[CharonY]

The first thing you need to get is that RNA is just transcribed DNA. Ie the sequence is complementary to the DNA strand getting transcribed. Now, the promoter is a specific DNA sequence upstream of the actual part of the DNA that gets transcribed into RNA. Essentially it is a regulatory element to which an enzyme, the DNA dependent RNA polymerase, together with certain other factors, bind in order to create the complex that does the actual transcription from DNA to RNA. It is often also the target for regulatory elements that enhance or reduce the binding efficiency of the complex and thus regulate the transcription rate.

[alan2here]

The first thing you need to get is that RNA is just transcribed DNA. Ie the sequence is complementary to the DNA strand getting transcribed.

Thanks, armed with this new knowlege I looked up the converstion. The DNA "ACTG" transcribes into the RNA "ACUG".

 

Now, the promoter is a specific DNA sequence upstream of the actual part of the DNA that gets transcribed into RNA.

ty, an important part.

 

Essentially it is a regulatory element to which an enzyme, the DNA dependent RNA polymerase, together with certain other factors, bind in order to create the complex that does the actual transcription from DNA to RNA. It is often also the target for regulatory elements that enhance or reduce the binding efficiency of the complex and thus regulate the transcription rate.

Best start our DNA sequence with a premotor or nothings going to happen, and then have something that will be transcribed to "AUG" so thats "ATG" so that the RNA that is created contains a start instruction and then "TAA" which converts to "UAA" which is one of the stop codons.

 

The spaces in the below sequence don't represent anything except a change of function.

 

TAATACGACTCACTATAGGGAGA ATG UAA

 

TTGTCTGG A U
AAACTAGA T A
ACCAAGA? G A

 

[Premoter] [start] [stop]

 

DNA Program 1
Premote(Start, Stop)

 

I presume (guestimate) that upstream means before and to the left?

Edited September 11, 2009 by alan2here

[CharonY]

Thanks, armed with this new knowlege I looked up the converstion. The DNA "ACTG" transcribes into the RNA "ACUG".

 

Actually it is always the complementary base. That is A pairs with T (or U) and G with C (and vice versa). So if the DNA sequence on the strand to be transcribed ist ACTG the RNA sequence would read UGAC. The whole system works unidirectional (5' to 3') so towards the 5' is considered up and the reverse downstream. Also in addition to the actual start codon the mRNA also contains more sequences that are not transcribed into a protein but are necessary for transcription (i.e. ribosomal binding site).

[alan2here]

I was using this diagram and had determined.

http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Transcription.html

 

A --> A

C --> C

T --> U

G --> C

 

 

I don't understand how the transcription works if.

DNA "ACTG" --> RNA "UGAC"

 

Is it?

 

A --> U

C --> G

T --> A

G --> C

 

However you talked about pairing with AT & CG. What did you mean?

 

Also in addition to the actual start codon

Required as well as the start codon to indicate the start of an RNA to be read?

 

Also in addition to the actual start codon the mRNA also contains more sequences that are not ... but are necessary for transcription.

I thought it was the premoter that started the transcription and the start codon was something to be transcribed onto the mRNA? So the other sequences required for transcription go with the premoter? Presumably the DNA has to tell the RNA it just created to start at that particular start connection (the one we put at the start codon)?

 

transcribed into a protein

DNA creates RNA.

RNA creates Proteins and can compute?

I'm preposing that proteins do things, they act on the world?

 

(i.e. ribosomal binding site)

I found more than one possible sequence for this to choose from? Sounds like this like the others you mentioned are to do with the premoter?

Edited September 12, 2009 by alan2here