blazinfury Posted March 16, 2013 Posted March 16, 2013 I am having trouble reading a Sanger Sequenced gel. I have tried to reason it out and would appreciate someone commenting about how I am approaching this. Thank you. When one does Sanger sequencing, the DNA strands are separated from each other and primers are used to sequence a portion of the DNA. Now, the template strand is used (and NOT the coding strand) in sequencing correct? If so, lets say that you have this gel below. If the gel is read bottom to top, you are reading 5' to 3' of the coding stranding, correct? So in this case, that would mean that the coding strand is: 5' ACGCCCGAGTAGCCCAGATT 3'. This strand is the complement of my template strand and thus, my template strand would be 5' AATCTGGGCTACTCGGGCGT 3'. If I were asked for the mRNA sequence, I would just take the complement of the template strand or just replace all of the T's with U's in the coding strand, correct. So my mRNA sequence would be 5' ACGCCCGAGUAGCCCAGAUU 3'. Is this correct?
CharonY Posted March 17, 2013 Posted March 17, 2013 Now, the template strand is used (and NOT the coding strand) in sequencing correct? If so, lets say that you have this gel below. Nope, during sequencing you can take either strand. In most cases you will actually sequence both. The question regarding coding strand and mRNA is thus not related to Sanger sequencing. If you had the finalized sequence and were to derive the mRNA you would obviously need which is the coding strand.
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now