pmtu79 Posted September 10, 2014 Posted September 10, 2014 Lastweek, I synthesized cDNA from HEK293 cells and amplify RAD51-AP1 mRNA (BC016330.1) by PCR with the annealing temp of 65oC and with following primers: F-EcoRI: AT GAATTC A ATGGTGCGGCCTGTGAG; R-BamHI: AA GGATCC TCAGGTGCTAGTGGCATTTG and then I cloned this amplified fragment into P3XFLAG-CMV10 vector. However, the result of sequencing showed that I already cloned another gene which is CORO7-PAM16 mRNA. Please help me.
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now